File:2RO2 2.jpg
From Wikimedia Commons, the free media repository
Jump to navigation
Jump to search
2RO2_2.jpg (779 × 540 pixels, file size: 60 KB, MIME type: image/jpeg)
File information
Structured data
Captions
Summary[edit]
Description2RO2 2.jpg |
Русский: РНК последовательность gggagaccugaaguggguuuccc |
Source | Own work |
Author | SergeyJ |
Licensing[edit]
I, the copyright holder of this work, hereby publish it under the following licenses:
This file is licensed under the Creative Commons Attribution-Share Alike 3.0 Unported license.
- You are free:
- to share – to copy, distribute and transmit the work
- to remix – to adapt the work
- Under the following conditions:
- attribution – You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.
- share alike – If you remix, transform, or build upon the material, you must distribute your contributions under the same or compatible license as the original.
Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.2 or any later version published by the Free Software Foundation; with no Invariant Sections, no Front-Cover Texts, and no Back-Cover Texts. A copy of the license is included in the section entitled GNU Free Documentation License.http://www.gnu.org/copyleft/fdl.htmlGFDLGNU Free Documentation Licensetruetrue |
You may select the license of your choice.
File history
Click on a date/time to view the file as it appeared at that time.
Date/Time | Thumbnail | Dimensions | User | Comment | |
---|---|---|---|---|---|
current | 03:04, 21 January 2010 | 779 × 540 (60 KB) | SergeyJ (talk | contribs) | {{Information |Description={{ru|1= РНК последовательность gggagaccugaaguggguuuccc}} |Source={{own}} |Author=SergeyJ |Date= |Permission= |other_versions= }} Category:RNA polymerase |
You cannot overwrite this file.
File usage on Commons
There are no pages that use this file.
File usage on other wikis
The following other wikis use this file:
- Usage on ru.wikiversity.org
Structured data
Items portrayed in this file
depicts
image/jpeg
229f33f81d90bce08ec8f1bb8cf407d6e159354e
61,652 byte
540 pixel
779 pixel
Hidden categories: